CPSC 545/445 - Assignment 1 (covers Module 1)

handed out Tue, 03/09/23; due Tue, 03/09/30


1 DNA, RNA, Proteins [5 marks]

Consider the following (incomplete) eukaryotic mRNA sequence:

5'-AAAUGUCUGCUCUGCUGAUC ... CUUUUUCAGGGGGGUUAAUC -3'

(a) What is the corresponding complementary DNA sequence? [1 mark]

(b) What is the amino-acid sequence of the corresponding gene product (protein)? [2 marks]

(c) What can you say about the structure of the genomic DNA sequence from which this (mature) mRNA was transcribed? How would you answer the same question if the mRNA were prokaryotic? [2 marks]

(Hint: Think about all steps in the process of protein synthesis from genomic DNA in eukaryotes and prokaryotes: transcription, ...)


2 Literature study / Selenocysteine insertion [7 marks]

Read the paper "Sequences in the 3'-untranslated region of the human cellular glutathione peroxidase gene are necessary and sufficient for selenocysteine incorporation at the UGA codon." by Shen et al., J Biol Chem. 1993 May 25; 268(15):11463-9. and answer the following questions. (In order to answer these questions you don't have to understand all technical details.)

(a) Which base triplet codes for selenocysteine in the mRNA of selenoproteins and which other function does that codon have? [2 marks]

(b) Which factors decide how the ambiguous selenocysteine codon is interpreted during translation in E.coli? (<= 100 words) [2 marks]

(c) Briefly explain the results regarding the mechanism used for correctly translating selenocysteine codons in higher eukaryotes, such as human and rat, as presented in this paper. In particular, highlight differences / similarities to the mechanism in prokaryotes, such as E.coli. (<= 100 words) [3 marks]


3 Terms and concepts [6 marks]

Provide brief explanations (at most 50 words each) in the style of short dictionary entries for the following terms and concepts:

(a) PCR [1 mark]

(b) gel electrophoresis [1 mark]

(c) enzyme [1 mark]

(d) gene expression [1 mark]

(e) snoRNA [2 marks]

Give all explanations in your own words Specify the sources of information (books, papers, webpages, etc.) you consulted for your answers.

Example:

dNTP: Deoxiribonucleoside Triphosphate {dATP, dCTP, dGTP, dTTP} [1]; also called nucleotides, dNTPs are the basic components of DNA strands. They are the building blocks required to make copies of a DNA strand [3] and are used in PCR, DNA labeling, and DNA sequencing [2].

[1] Epicentre Company, https://www.epicentre.com/pdftechlit/037pl111.pdf
[2] BioCarta Company, https://www.biocarta.com/TDS/ntp-10001.pdf
[3] University of Washington Genome Center, "Sequencing Tutorial", https://www.genome.washington.edu/UWGC/tutorial/SequencingPCR.cfm


General remarks: