CPSC445/545 - Assignment 4 (covers Module 5 & 6)

NOTE: CPSC 545 students are only required to solve problems 1 and 4; CPSC 445 students are expected to solve all problems.

1  RNA secondary structure [7 marks]

(a) Given a figure (Figure 1) of the RNA molecule, name all of the secondary structure elements, and give their base pair position.
[2 marks]

(b) Make structure from part (a) pseudoknot free by removing minimal number of bases. [1 marks]

(c) Calculate energy of the structure given in Figure 2, based on the Zuker's energy parameters that can be found at http://www.bioinfo.rpi.edu/~zukerm/rna/energy/, use tables for 37 degree Celsius for RNA folding. [4 marks]

2  RNA secondary structure exploration with software tools (Hands-on Problem) [445 students only, 7 marks]

(a) Given a sequence of biological pseudoknotted XS1 rybozyme, use MFOLD program of Zucker et al. to predict secondary structure, and compare optimal structure to the original biological structure given in Figure 3. What do you notice? RNA sequence is:
GCGAGAAACCCAAAUUUUGGUAGGGGAACCUUCUUAACGGAAUUC
AACGGAGAGAAGGACAGAAUGCUUUCUGUAGAUAGAUGAUUGCCG
CCUGAGUACGAGGUGAUGAGCCGUUUGCAGUACGAUGGAACAAAA
CAUGGCUUACAGAACGUUAGACCACUUACAUUUGGGAUCCUAACG
UUCGGGUAAUCGCUGCAGAUCUUGAAUCUGUAGAGGAAAGUCCAU
GCUCGCACGGUGCUGAGAUGCCCGUAGUGUCCAGACUGAAGAUCU
GGAGGUCCUGUGUUCGAUCCACAGAAUUCGCACCAGCGGAUUUA
[2 marks]

(b) Given a sequence of a small RNA structure depicted in figure, design a small piece of RNA that when both sequences are inputed in PairFold program of Andronescu et. al, the stem and the internal loop marked in red in the Figure 4 will dissapear. RNA sequence is: ACAGAGAAACAGACGUUGUGGUCUGACAAACUCU [2 marks]

(c) [3 marks]
(i) Design a sequence that folds into the structure given in the parenthesis notation:

((((((.((.(((((((((.......(((...))).........)))))..))))..)))))))).

using DESIGNER program of Andronescu et. al.
(ii) Fold the original biological sequence:
AAACAGAGAAGUCAACCAGAGAAACAGACGUUGUCGUAUAAUACCUGGUACUGACAGUCCUGUUUU
using MFOLD.
(iii) Comment on the energies of structures obtained by MFOLD and the energy calculated by the RNA DESIGNER.

3  Protein structure prediction [445 students only, 3 marks],

Given a protein structure on the 2 dimensional lattice under Hydrophobic Polar (HP) model, design a sequence that folds into the target structure producing minimal free energy and has a maximum of 10 hydrophobic (h) amino acids, specify both the designed sequence and its minimal free energy. [3 marks]

4  Knowledge testing questions [10 marks]

(a) Explain when threading and when homology is an appropriate method for protein structure prediction. [2 marks]

(b) Explain the difference between protein fold and protein domain (cite any sources where appropriate). [1 marks]

(c) Explain the difference between secondary and super-secondary protein structure. [1 marks]

(d) List three reasons why normalization is performed on microarray data before analysis. [3 marks]

(e) Imagine that you decided to test gene expression in normal and mutant mice, you carried out microarray experiment, extracted gene expression data, and made a scatter plot of relative expression for all genes (of normal versus mutant condition), what do you expect the scatter plot looks like knowing that only few genes are differentially expressed? [3 marks]

General remarks:

• While cooperation between students - especially between CS and non-CS students - is encouraged, each student is expected to work out the actual solutions to the problems individually and hand in their own assignment. In other words: help each other, but do not copy solutions.
• Feel always free to contact Holger, Alena, or Dan if you feel you need further help than can be provided by your fellow students.
• The assignment has to be handed in on the date it is due before or at the beginning of class.
• This assignment should take you about 4-5 hours of work, if you have good knowledge of the topics covered and did all reading assignments. However, don't wait until the last minute relying on this estimate - it might not apply to you (or anyone at all), you might need additional time to consult the literature, ...
• Electronic Handin: Please hand in the assignment electronically by sending a PDF file (sorry, no other formats are supported) using a tool called "handin" or hand in a hardcopy. The tool is available on the grad and undergrad machines. The name of the course is cs445 for undergrads or cs545 for grads. The name of the assignment is a3 (Unix is case sensitive, so make sure you use lowercase only). See also "man handin" is you need additional information on how to use handin.
• Late Assignments / Multiple Submissions: Late assignments will not be accepted by the system and cannot be marked (i.e. 0 marks by default). If you submit an assignment multiple times (before the due date), the latest version automatically replaces any previous versions and only the latest version will be marked.